Home » Tenders By Product » Latest Nucleotide Tenders

Latest Nucleotide Tenders and eProcurement Notices

In this section the users can find latest Nucleotide tenders and eProcurement notices from various tendering authorities and private purchasers in India. Registered users can download complete tender detail, BOQ, TOR etc for Nucleotide Tenders, published by various government tendering authorities in India.

The information on Nucleotide online tenders is sourced from various sources like: State Government Eproc Portals, Newspapers, tender bulletin and government online tenders websites.

State: Maharashtra

Supply of Tablet Tenofovir Alafenamide (Nucleotide Reverse Transcriptase Inhibitor) Qty 15000 Tablet at Mumbai

Ref ID: 145905625

Deadline: 27Aug2026

Value: Refer Document

State: Uttar Pradesh

Oligo Nucleotide, Qty: 1 Packet, (BOQ Item #57)

Ref ID: 144420949

Deadline: 22Jul2026

Value: Refer Document

State: Delhi

Supply of Pre Term Formula Should With Lutein, Dha, Natural Vit E, Nucleotides At Levels 46 47 Mg In 100 G Of Powder Qty 200 at New Delhi

Ref ID: 138505718

Deadline: 27Apr2026

Value: Refer Document

State: Delhi

Supply of Labetolol Injection 20 Mg/Ml 1 Per Vial, Infant Formula With Nucleotides Powder 100 Gm 100 Gm Per Pack at Delhi

Ref ID: 137963086

Deadline: 03Apr2026

Value: Refer Document

State: Rajasthan

Nucleotide Sequence, Qty: 82

Ref ID: 137170674

Deadline: 26Mar2026

Value: Refer Document

State: Maharashtra

Supply of Tablet Tenofovir Alenfenamide (Nucleotide ReverseTrainscriptase Inhibitor) Qty 15000 at Mumbai

Ref ID: 130880229

Deadline: 15Jan2026

Value: Refer Document

State: Uttarakhand

Corrigendum: SHRV IPC2 rev, 5 CAGTCTCGGGCTTGACTAATG 3 21 nucleotides, Qty: 1 Pack, (BOQ Item #74)

Ref ID: 129448977

Deadline: 10Nov2025

Value: Refer Document

State: Uttarakhand

Corrigendum: SHRV IPC2 fwd, 5 TGGATTCAGTGTAAAGGAGGTTC 3 23 nucleotides, Qty: 1 Pack, (BOQ Item #73)

Ref ID: 129448976

Deadline: 10Nov2025

Value: Refer Document

State: Uttarakhand

Corrigendum: Shrv 2 R, 5 CTGCGATCCAAAAAC CTTGG 3 20 nucleotides, Qty: 1 Pack, (BOQ Item #72)

Ref ID: 129448975

Deadline: 10Nov2025

Value: Refer Document

State: Uttarakhand

Corrigendum: Shrv 2 F, 5 AGCGGTCACAGAATG CGATA 3 20 nucleotides, Qty: 1 Pack, (BOQ Item #71)

Ref ID: 129448974

Deadline: 10Nov2025

Value: Refer Document

State: {{rowDetails.State_Name}}

Ref ID: {{rowDetails.ID}}

Deadline: {{rowDetails.Bid_Deadline_1}}

Value: {{rowDetails.Tender_Value}}

No data Found!! Please search again

Browse Tenders

Browse Tenders from below Sections