Register Subscribe +91 9987273457

Login


Forgot Password?

OR

Login with Google

REGISTER


Continue with Google

OR

Email ID Already Exist !

What Users Get:

  • Website Access to Download Unlimited Number of Tenders

  • Customised Daily Email Alerts for Chosen Product/Services

  • Facility to Download and Export Tenders in Excel Format

  • Access to Huge Archival Database of Tenders

  • Help in Getting Digital Signature Certificates

  • Tender Bidding Support Services From Expert Consultant

    • Complete Your Profile


    Change Password


    Request a Password Reset


    Enter your email below and we'll send you instructions to reset your password.

    Home > Tenders > Kfd Rt-Pcr Regaents Tender For The Vdlshimoga 2025-26

    Tender for Kfd Rt-Pcr Regaents Tender For The Vdlshimoga 2025...

    Download Document

    Tender for Kfd Rt-Pcr Regaents Tender For The Vdlshimoga 2025-26 from Karnataka. The reference number of the tender is: 126537302 and the same is closing on 17th Oct 2025. Users can register on the site to get similar tenders.

    Procurement Summary

    Download Document

    Country : India

    State : Karnataka

    Summary : Kfd Rt-Pcr Regaents Tender For The Vdlshimoga 2025-26

    Deadline : 17 Oct 2025

    Purchaser's Detail

    Register to see full purchaser details. Register to see full purchaser details. Register to see full purchaser details. Register to see full purchaser details. Register to see full purchaser details. Register to see full purchaser details. Register to see full purchaser details. Register to see full purchaser details.

    Register to see full details

    Other Information

    Notice Type : Tender

    RefID : 126537302

    Notice Ref. No. : DHFWS/2025-26/IND1815

    Tender Value : ₹ 6051502.00

    Tender EMD : ₹ 150000.00

    Tender Document Cost : ₹ 500

    Competition : NCB

    Financier : Self Financed

    Purchaser Ownership : Public

    Tender's Details

    Supply Of Kfd Rt-Pcr Reagents For Virus Diagnostic Laboratory Shimoga
    1. Beta Actin QSY Probe VIC5TCAAGATCATTGCTCCTCCTGAGCGC3 50000picomoles, Qty: 2.00 Unit, Amt: 432488.00
    2. Actin RP5GCCGATCCACACGGAGTACT3 80000picomoles, Qty: 3.00 Unit, Amt: 45672.00
    3. Actin FP5GGCACCCAGCACAATGAAG3 80000picomoles, Qty: 3.00 Unit, Amt: 45672.00
    4. TaqMan Fast Virus 1 Step Master Mix for qPCR Catalog number 4444434 1 Qty 200x5, Qty: 18.00 Unit, Amt: 5003838.00
    5. TaqMan QSY Probe-50nm KFDV NS5 PROBE 6FAM ATG GAG AGG AGC GCC TGA CCC G 22 bases CATALOG NO 4482779 5...
    Category: GOODS
    EMD: 150000.00
    Est Amt: 6051502.00
    Entity Type: Government Department
    Tender Fees: 500.00

    Notice Documents

     Tender Notice

    Virus-Diagnostic-Laboratory-BH-Road-Shimoga-Department-of-Health-and-Family-Welfare-Government-of-Ka-2-.pdf

    Want To Bid in This Tender?

    Get Local Agent Support for this Tenders.

    ContactUs

    Publish Tenders/RFP

    Have Any Dispute With The Purchaser?

    1 State

    Rs. 2500 + GST

    • Unlimited Website Access

    • Unlimited Tenders Download

    • Unlimited Keyword Search

    • Access to Archive Tenders

    • Number of Accounts-1

    •   Contract Awards

    • Dedicated Key Account Manager

    • 24*7 Customer Support

    • Validity-12 Months

    5 States

    Rs. 5000 + GST

    • Unlimited Website Access

    • Unlimited Tenders Download

    • Unlimited Keyword Search

    • Access to Archive Tenders

    • Number of Accounts-2

    •   Contract Awards

    • Dedicated Key Account Manager

    • 24*7 Customer Support

    • Validity-12 Months

    All India

    Rs. 9000 + GST

    • Unlimited Website Access

    • Unlimited Tenders Download

    • Unlimited Keyword Search

    • Access to Archive Tenders

    • Number of Accounts-3

    •   Contract Awards

    • Dedicated Key Account Manager

    • 24*7 Customer Support

    • Validity-12 Months

    Indian State Tenders

    View More

    Indian City Tenders

    View More

    Products/Keywords

    View More

    Indian Authority Tenders

    View More

    Browse Tenders

    Browse Tenders from below Sections

    Indian States

    Indian Cities

    Products/Keywords

    purchasers