Login
REGISTER
What Users Get:
Complete Your Profile
Change Password
Request a Password Reset
Procurement Summary
Country: India
State: Delhi (NCT)
Summary: 14 DNA Extraction Kit, Qty: 6 Kits, (BOQ Item #13)
Posting Date: 11 Mar 2026
Deadline: 01 Apr 2026
Purchaser's Detail
Other Information
Notice Type: Tender
RefID: 137575267
Notice Ref. No.: GEM/2026/B/7344283
Tender Value: Refer Document
Tender EMD: ₹ 8370
Tender Document Cost: Refer Document
Competition: NCB
Financier: Self Financed
Purchaser Ownership: Public
Tender's Details
BOQ Item Description: DNA Extraction Kit for Human blood samples spin column based 250 PREP
BOQ Title: Primers DNA LADDER and other consumables, Nucleic Acid Extraction Kit (For Research Use Only) Oligonucleotides PCR Primer PCR Master Mix for I...
Item Title: 14 DNA Extraction Kit
Item Quantity: 6
Unit of Measure: Kits
Delivery Period (In number of days): 30
Start Date: 11-03-2026 3:02 PM
End Date: 01-04-2026 4:00 PM
EMD Amount: 8370
BOQ Title: Primers DNA LADDER and other consumables
GeMARPTS Searched: Searched String: Forward CAAGCTACTGCATACTCGAAATCAC 25bp XLPE Cable for Working Voltage up to and Including 1.1 KV Marked To IS 7098 (Part 1), Electronic Weighing Scales, Molded Case Circuit Breakers (MCCB) as per IS / IEC 60947, Parallel Bar - Outdoor Gym Equipment, Permeable Nonwoven Surgical Adhes...
Get Local Agent Support for this Tenders.
ContactUs1 State
Rs. 2500 + GST
Unlimited Website Access
Unlimited Tenders Download
Unlimited Keyword Search
Access to Archive Tenders
Number of Accounts-1
Dedicated Key Account Manager
24*7 Customer Support
Validity-12 Months
5 States
Rs. 5000 + GST
Unlimited Website Access
Unlimited Tenders Download
Unlimited Keyword Search
Access to Archive Tenders
Number of Accounts-2
Dedicated Key Account Manager
24*7 Customer Support
Validity-12 Months
All India
Rs. 9000 + GST
Unlimited Website Access
Unlimited Tenders Download
Unlimited Keyword Search
Access to Archive Tenders
Number of Accounts-3
Dedicated Key Account Manager
24*7 Customer Support
Validity-12 Months
Browse Tenders from below Sections