Tender for 14 DNA Extraction Kit, Qty: 6 Kits, (BOQ Item #13)

The MINISTRY OF HEALTH AND FAMILY WELFARE, a Public sector organization in India, has invited bids for 14 DNA Extraction Kit, Qty: 6 Kits, (BOQ Item #13) in South West Delhi, Delhi (NCT), India.

As per the official tender notification (Tender ID: GEM/2026/B/7344283 | Ref ID: 137575267). The estimated tender value is Refer Document, with an Earnest Money Deposit (EMD) of ₹ 8370.

The tender is published on 11 Mar 2026, and the last date for bid submission is 01 Apr 2026.

All Eligible contractors, suppliers, and service providers from Primers DNA LADDER and other consumables, Nucleic Acid Extraction Kit (For Research Use Only) Oligonucleotides PCR Primer PCR Master Mix for I... category are invited to participate in this opportunity, subject to meeting the prescribed eligibility criteria and tender conditions.

Notice Status: This Tender has Expired. While the deadline of 01 Apr 2026 has passed, this record remains available for historical reference, price benchmarking, and industry tracking purposes in Delhi (NCT).

Don’t Miss the Next Opportunity!

Although this specific window is closed, thousands of similar Primers DNA LADDER and other consumables, Nucleic Acid Extraction Kit (For Research Use Only) Oligonucleotides PCR Primer PCR Master Mix for I... Tender are opening soon. Register FREE on IndianTender.in today to receive real-time alerts for upcoming Government and Private Tender notices across India. Join 1,000+ proactive suppliers and contractors who stay ahead of the competition in Delhi (NCT).

Register for FREE |

Procurement Summary

Country: India

State: Delhi (NCT)

Summary: 14 DNA Extraction Kit, Qty: 6 Kits, (BOQ Item #13)

Posting Date: 11 Mar 2026

Deadline: 01 Apr 2026

Purchaser's Detail

Register to see full purchaser details. Register to see full purchaser details. Register to see full purchaser details. Register to see full purchaser details. Register to see full purchaser details. Register to see full purchaser details. Register to see full purchaser details. Register to see full purchaser details.

Other Information

Notice Type: Tender

RefID: 137575267

Notice Ref. No.: GEM/2026/B/7344283

Tender Value: Refer Document

Tender EMD: ₹ 8370

Tender Document Cost: Refer Document

Competition: NCB

Financier: Self Financed

Purchaser Ownership: Public

Tender's Details

BOQ Item Description: DNA Extraction Kit for Human blood samples spin column based 250 PREP
BOQ Title: Primers DNA LADDER and other consumables, Nucleic Acid Extraction Kit (For Research Use Only) Oligonucleotides PCR Primer PCR Master Mix for I...
Item Title: 14 DNA Extraction Kit
Item Quantity: 6
Unit of Measure: Kits
Delivery Period (In number of days): 30
Start Date: 11-03-2026 3:02 PM
End Date: 01-04-2026 4:00 PM
EMD Amount: 8370
BOQ Title: Primers DNA LADDER and other consumables
GeMARPTS Searched: Searched String: Forward CAAGCTACTGCATACTCGAAATCAC 25bp XLPE Cable for Working Voltage up to and Including 1.1 KV Marked To IS 7098 (Part 1), Electronic Weighing Scales, Molded Case Circuit Breakers (MCCB) as per IS / IEC 60947, Parallel Bar - Outdoor Gym Equipment, Permeable Nonwoven Surgical Adhes...

1 State

Rs. 2500 + GST


  • Unlimited Website Access

  • Unlimited Tenders Download

  • Unlimited Keyword Search

  • Access to Archive Tenders

  • Number of Accounts-1

  •   Contract Awards
  • Dedicated Key Account Manager

  • 24*7 Customer Support

  • Validity-12 Months

5 States

Rs. 5000 + GST


  • Unlimited Website Access

  • Unlimited Tenders Download

  • Unlimited Keyword Search

  • Access to Archive Tenders

  • Number of Accounts-2

  •   Contract Awards
  • Dedicated Key Account Manager

  • 24*7 Customer Support

  • Validity-12 Months

All India

Rs. 9000 + GST


  • Unlimited Website Access

  • Unlimited Tenders Download

  • Unlimited Keyword Search

  • Access to Archive Tenders

  • Number of Accounts-3

  •   Contract Awards
  • Dedicated Key Account Manager

  • 24*7 Customer Support

  • Validity-12 Months

Browse Tenders

Browse Tenders from below Sections